GIMAP8 (6 of 111)

Ensembl ID:
ENSDARG00000095531
Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31244 Nonsense Mutation detected in F1 DNA During 2017
sa39718 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143063 Nonsense 71 274 3 3
Genomic Location (Zv9):
Chromosome 1 (position 57256147)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150566.1 3993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGAAAAACTGGAGCTGGAAAGAGCGCGACAGGAAACACCATCCTGAGA[C/T]AAAAGCTTTTTGATGAAAAAGATTCATTAAGTTCCGTGACCAAAAATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143063 Nonsense 197 274 3 3
Genomic Location (Zv9):
Chromosome 1 (position 57256525)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150566.1 4371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCATAGAGGAGTTTCTGGCAAATAACAAGCAGATGATAGCACTAGCT[G/T]AACAGTGTAAAGGTGGATATCATGTCTTCAACAACACAGATGAACAAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link