btr27

Ensembl ID:
ENSDARG00000095500
ZFIN ID:
ZDB-GENE-070705-379
Description:
Novel protein similar to bloodthirsty (Bty) [Source:UniProtKB/TrEMBL;Acc:A5WUZ3]
Human Orthologues:
CTD-2611O12.2, CTD-2611O12.3, ERMAP, RFPL1, RFPL2, RFPL3, RFPL4A, RFPL4B
Human Descriptions:
erythroblast membrane-associated protein (Scianna blood group) [Source:HGNC Symbol;Acc:15743]
ret finger protein-like 1 [Source:HGNC Symbol;Acc:9977]
ret finger protein-like 2 [Source:HGNC Symbol;Acc:9979]
ret finger protein-like 3 [Source:HGNC Symbol;Acc:9980]
ret finger protein-like 4A [Source:HGNC Symbol;Acc:16449]
ret finger protein-like 4B [Source:HGNC Symbol;Acc:33264]
Mouse Orthologues:
Ermap, Rfpl4
Mouse Descriptions:
erythroblast membrane-associated protein Gene [Source:MGI Symbol;Acc:MGI:1349816]
ret finger protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2149590]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25082 Nonsense Mutation detected in F1 DNA During 2017
sa29135 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25083 Nonsense Mutation detected in F1 DNA During 2017
sa32230 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132370 Nonsense 15 549 2 8
ENSDART00000139694   None 519 None 6

The following transcripts of ENSDARG00000095500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 4871916)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4145477
KASP Assay ID:
554-7880.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACAATGGCAGAATCTTCACCAACATCAACAAAAGGAAAAGAAACCTG[G/A]AGAGGAAGTCAAGATGTTTTACCTCCATGTAAGTCAATTATCTTGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132370 Essential Splice Site 25 549 None 8
ENSDART00000139694   None 519 None 6

The following transcripts of ENSDARG00000095500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 4871946)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4145507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAAGGAAAAGAAACCTGGAGAGGAAGTCAAGATGTTTTACCTCCATG[T/A]AAGTCAATTATCTTGAAAAATATCCTAATGAATATTGTAATATTTAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132370 Nonsense 38 549 3 8
ENSDART00000139694 Nonsense 15 519 1 6

The following transcripts of ENSDARG00000095500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 4873455)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4147016
KASP Assay ID:
554-7601.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTTCCAGATATGTCCTCCTCCAGTAATCCACTGTCTGAGGAGCTT[C/T]AGTGCTCAATATGTCTGGAGGTGTTCACTGATCCGGTCAGCACTCCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132370 Essential Splice Site 375 549 None 8
ENSDART00000139694 Essential Splice Site 346 519 None 6

The following transcripts of ENSDARG00000095500 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 4878706)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4152267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATCATAATATTCACTCTGATTATTAGTAATTTATATTCTGTTTTCTC[A/G]GTGGATGTTACTCTGGATCCTGATACAGCTCATCCTAAACTCATCCTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link