si:ch211-59c24.3

Ensembl ID:
ENSDARG00000095496
ZFIN ID:
ZDB-GENE-060503-701
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MTA3]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16748 Nonsense Available for shipment Available now
sa36584 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44883 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133555   None 129 None 5
ENSDART00000147613 Nonsense 328 1017 5 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 10337209)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10920455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGAAGAGTGCAGAGATTAGAAAAAGTTTAGGGCTYACTCCCCTGGAA[C/T]GAAGCAAAACTGYGGTGGAGAAGAGCATTGTGAAAACKCCAACACCCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133555   None 129 None 5
ENSDART00000147613 Essential Splice Site 783 1017 None 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 10338576)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10921822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGAGACTCGGGGAAGAAGAAAGATTCACCCCTGGACAGGTCCTCAGG[T/C]CAGCTGGAAGTTTTTCATTTGAATGGCTCATCTTTTTTTCTAGCAGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133555 Nonsense 88 129 5 5
ENSDART00000147613 Nonsense 976 1017 12 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 10369292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGACAGAGGAGGAGCTGGCAGAGGAGAAGCAGATTCTGAATGAGATGT[T/A]GGAGGTGGTGGAGCAGCGAGACTCTCTGGTGGCCCTGCTGGAGGAACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link