si:ch211-59c24.3

Ensembl ID:
ENSDARG00000095496
ZFIN ID:
ZDB-GENE-060503-701
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MTA3]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16748 Nonsense Available for shipment Available now
sa36584 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133555   None 129 None 5
ENSDART00000147613 Nonsense 328 1017 5 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 10337209)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10920455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGAAGAGTGCAGAGATTAGAAAAAGTTTAGGGCTYACTCCCCTGGAA[C/T]GAAGCAAAACTGYGGTGGAGAAGAGCATTGTGAAAACKCCAACACCCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133555   None 129 None 5
ENSDART00000147613 Essential Splice Site 783 1017 None 12

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 10338576)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10921822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGAGACTCGGGGAAGAAGAAAGATTCACCCCTGGACAGGTCCTCAGG[T/C]CAGCTGGAAGTTTTTCATTTGAATGGCTCATCTTTTTTTCTAGCAGTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link