si:ch211-86k6.3

Ensembl ID:
ENSDARG00000095452
ZFIN ID:
ZDB-GENE-091204-227

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12466 Essential Splice Site Available for shipment Available now
sa9769 Essential Splice Site Available for shipment Available now
sa43603 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131570 Essential Splice Site 23 191 2 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12147568)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13848742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGCTGCAGCAACNNNAAGGCRGACATGCCATCTTTGACCCAGACAGG[T/C]AGCCATTTTTTAAATGTTGGTGTACAGATATTGTAAAAAACAGAAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131570 Essential Splice Site 78 191 3 5
ENSDART00000131570 Essential Splice Site 78 191 3 5
ENSDART00000131570 Essential Splice Site 78 191 3 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12145961)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13847135
KASP Assay ID:
2261-5376.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAGATGTSCTTTCTGCATCCATGCTGGAGCCTGAACCAGTGCCTGAG[G/A]TTCCTCAAAATKACTCCTAAACATCACTCACATATGACCTCATGGGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131570 Nonsense 136 191 5 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12144549)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13845723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTGATATTTCAATATCTCTTTCTCATGGTCTTCTCACCTTCAGCTA[T/A]CAGAGTGTTAAAGAGCTCCCCGGGACACTGGATCAGGCTGTGACTTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link