si:ch1073-75f15.2

Ensembl ID:
ENSDARG00000095394
ZFIN ID:
ZDB-GENE-081031-89
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JLP5]
Human Orthologue:
C15orf60
Human Description:
chromosome 15 open reading frame 60 [Source:HGNC Symbol;Acc:25065]
Mouse Orthologue:
2410076I21Rik
Mouse Description:
RIKEN cDNA 2410076I21 gene Gene [Source:MGI Symbol;Acc:MGI:1920923]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23201 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa23201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135090 Missense 69 140 2 4

The following transcripts of ENSDARG00000095394 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 956081)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 1264018
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAATGGATCTATTTCTGTCTCTTCTTCAGGCCCCTGAAGATGCTCCAC[G/T]GGCAGCCCCTGCTGTTGCTGAGGGGCCGCTGTCAATCAAACACCTTTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link