si:ch211-191i18.4

Ensembl ID:
ENSDARG00000095328
ZFIN ID:
ZDB-GENE-060503-15
Description:
hypothetical protein LOC799350 [Source:RefSeq peptide;Acc:NP_001076400]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3024 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa3024
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132591 Nonsense 32 120 1 3
Genomic Location (Zv9):
Chromosome 19 (position 43758833)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 42668635
KASP Assay ID:
554-3270.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATATTTACTTTAAAACCAGTGGCGTCGAATCAAGACCRCCGGATTAC[C/T]AWCCAACTGGATTGTTTATCGACGACCCGACGGAARCGGTGAGTTAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link