galnt8b

Ensembl ID:
ENSDARG00000095324
ZFIN ID:
ZDB-GENE-041210-84
Description:
Novel protein similar to vertebrate UDP-N-acetyl-alpha-D-galactosamine polypeptide N-acetylgalactosa
Human Orthologue:
GALNT8
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8) [Sour

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11560 Nonsense Available for shipment Available now
sa17593 Nonsense Available for shipment Available now
sa20194 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140613 Nonsense 180 463 3 9
ENSDART00000147711 Nonsense 251 534 4 10
Genomic Location:
Chromosome 4 (position 5092453)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTATGTATGTGACATTCCCGRAGAAGTGGTACRAWCRAAACGAYCCTT[C/A]GCTGCCRGGAAAGTGAGTGTGCRTTGCTKCTTTYGTATTYCATGTTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140613 Nonsense 366 463 8 9
ENSDART00000147711 Nonsense 437 534 9 10
Genomic Location:
Chromosome 4 (position 5096000)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGAACATTTGACACACTTTAGTTTGTCYTYACACAGCAATTTTTCTA[T/A]ACAAMAAGTGGAGAGATATTWGTCGGTCCCCTTCAGCCCCTTTTACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140613 Essential Splice Site 417 463 8 9
ENSDART00000147711 Essential Splice Site 488 534 9 10
Genomic Location:
Chromosome 4 (position 5096155)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTCAGACACAGAGAAACCAAAACACATGTACTGGGACTTCAAACAGG[T/C]GAACTAATTATAAAACACTGATAGGATACTGTGGTGTACCACAGTCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jttqs7h1