si:ch211-74m13.1

Ensembl ID:
ENSDARG00000095312
ZFIN ID:
ZDB-GENE-081104-12
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JHX4]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1686 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142710 Nonsense 226 318 3 4
Genomic Location (Zv9):
Chromosome 3 (position 55636310)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54530036
KASP Assay ID:
554-1632.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGTTCAGCAGAGAACATCAGTCAGAGCGATACTGTCTATTTAAACTG[T/A]ACAGTGAAGGCAAACCCGGCTGCTGTGTACACATGGCACTCAGAGCATCT
Associated Phenotype:
Data not yet available

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link