NM_200623.1

Ensembl ID:
ENSDARG00000095305
Description:
WD repeat domain 46 (wdr46), mRNA [Source:RefSeq DNA;Acc:NM_200623]
Human Orthologue:
WDR46
Human Description:
WD repeat domain 46 [Source:HGNC Symbol;Acc:13923]
Mouse Orthologue:
Wdr46
Mouse Description:
WD repeat domain 46 Gene [Source:MGI Symbol;Acc:MGI:1931871]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27295 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141889 Essential Splice Site 71 147 None 3

The following transcripts of ENSDARG00000095305 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55409740)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53216617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCAGGCCAGCTTTGAGCAGAGACACAAGGAACGGGTTGAAGTAATGG[T/A]GAGTCGGCCTGACGCTATTAATGGTGATTTTTAATCAAACTGATGACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link