si:dkey-200l5.4

Ensembl ID:
ENSDARG00000095294
ZFIN ID:
ZDB-GENE-091204-393

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27586 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132690 Essential Splice Site 43 183 None 13
ENSDART00000135376 Essential Splice Site 52 191 None 13

The following transcripts of ENSDARG00000095294 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17772495)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17784841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGAAATGTAACGTTAGGCTAAATTACATGTGCGCCTCCTGTGTTTGT[A/T]GTGATTTCAGTGTCTCTGGAATCTGACGAAAGTAATGAATCATCCGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link