si:ch211-250o15.2

Ensembl ID:
ENSDARG00000095288
ZFIN ID:
ZDB-GENE-060526-131
Description:
Novel protein similar to vertebrate RUN and SH3 domain containing 2 (RUSC2) [Source:UniProtKB/TrEMBL
Human Orthologue:
RUSC2
Human Description:
RUN and SH3 domain containing 2 [Source:HGNC Symbol;Acc:23625]
Mouse Orthologue:
Rusc2
Mouse Description:
RUN and SH3 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2140371]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa419 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133247 Nonsense 738 829 9 10
Genomic Location (Zv9):
Chromosome 5 (position 21109810)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18822682
KASP Assay ID:
554-0280.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGTTGGATCTGGTGGCTCAGTCTGTTGGAGTTCGGAAAAGAGCGGAG[C/T]AACAATCTTTTACATCTCAAAGCCAAGAATCCAACCTTGGCCCAACTGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link