tnks

Ensembl ID:
ENSDARG00000095261
ZFIN ID:
ZDB-GENE-030131-7450
Human Orthologue:
TNKS
Human Description:
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase [Source:HGNC Symbol;Acc:11941]
Mouse Orthologue:
Tnks
Mouse Description:
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase Gene [Source:MGI Symbol;Acc:MGI:13

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18265 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa18265
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147294 Missense 278 292 3 3

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 21 (position 18773611)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTCTGCCCTGGACCTGGCCGACCCGTCCGCGAAAGCTGTCCTCACAG[G/A]YAAGTGCCACATTYTGTSTTTTATCAGTGTTTTGATCTTCAGCTGAACGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/427epdr1