si:dkey-19a16.11

Ensembl ID:
ENSDARG00000095195
ZFIN ID:
ZDB-GENE-091204-409

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24068 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132889 Essential Splice Site 107 245 2 3
Genomic Location (Zv9):
Chromosome 22 (position 6123302)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6169369
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTGTTTATTAAATTTGTTCTCATTTCTCTACCTTGTCTGATGTTTTC[A/G]GCTCGTCTGCCTGTTCCGGTCCTCATCTTCAACTCTTCTCAGTGTTCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link