lrrfip1b

Ensembl ID:
ENSDARG00000095170
ZFIN ID:
ZDB-GENE-050208-324
Description:
Novel protein similar to vertebrate leucine rich repeat (In FLII) interacting protein family [Source
Human Orthologue:
LRRFIP1
Human Description:
leucine rich repeat (in FLII) interacting protein 1 [Source:HGNC Symbol;Acc:6702]
Mouse Orthologue:
Lrrfip1
Mouse Description:
leucine rich repeat (in FLII) interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1342770]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9289 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141597 Nonsense 413 492 15 17
ENSDART00000143502 Nonsense 397 476 14 16
Genomic Location (Zv9):
Chromosome 6 (position 15429993)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15403225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTAACAGGCAGATCAGTGACCTGAAATTCAAGCTAGTCAAATCTGAA[C/T]AAGAAGTCACAGCACTTGAACAAAATGTAAGTCATGTATAAAATTAAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Adiposity: A Variant in the LRRFIP1 Gene Is Associated With Adiposity and Inflammation. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link