si:ch211-218m3.18

Ensembl ID:
ENSDARG00000095143
ZFIN ID:
ZDB-GENE-081031-29

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13267 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145844 Nonsense 92 312 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39139808)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40279873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTGCCACGCTTAATGCAAGACATGTTAAGGGASAGCTCAGAGCGTTA[T/A]ATATCATATGCGGAGTGTGTTGTTCMAGCTYATTTTGTCCATGTATTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link