ENSDARG00000095113

Ensembl ID:
ENSDARG00000095113
Human Orthologues:
CTD-2611O12.2, CTD-2611O12.3, ERMAP, RFPL1, RFPL2, RFPL3, RFPL4A, RFPL4B
Human Descriptions:
erythroblast membrane-associated protein (Scianna blood group) [Source:HGNC Symbol;Acc:15743]
ret finger protein-like 1 [Source:HGNC Symbol;Acc:9977]
ret finger protein-like 2 [Source:HGNC Symbol;Acc:9979]
ret finger protein-like 3 [Source:HGNC Symbol;Acc:9980]
ret finger protein-like 4A [Source:HGNC Symbol;Acc:16449]
ret finger protein-like 4B [Source:HGNC Symbol;Acc:33264]
Mouse Orthologues:
Ermap, Rfpl4
Mouse Descriptions:
erythroblast membrane-associated protein Gene [Source:MGI Symbol;Acc:MGI:1349816]
ret finger protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2149590]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5790 Essential Splice Site F2 line generated During 2016
sa35852 Nonsense Mutation detected in F1 DNA During 2016
sa15375 Nonsense Available for shipment Available now
sa42521 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5790
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144029   9 532 1 6
ENSDART00000147632 Essential Splice Site 10 531 None 7
Genomic Location (Zv9):
Chromosome 15 (position 17140390)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18260763
KASP Assay ID:
554-3517.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATTAATGAATTTTATGTGATAAATGGTTCTTCTTCATGTTTGTCTTC[A/G]GCTCTGTCAGAGGAGCTCCAGTGCTCAATCTGTCTGGATGCRTTCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144029 Nonsense 139 532 1 6
ENSDART00000147632 Nonsense 139 531 2 7
Genomic Location (Zv9):
Chromosome 15 (position 17140000)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18260373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAATTTAAAACACAAATTAATTGATCCTGTGTTGAATCTTGAGAACTA[T/A]ATATGTCAGAAACATGAGAAACCTCTGGAGCTGTTCTGTAAAGATGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144029 Nonsense 387 532 6 6
ENSDART00000147632 Nonsense 387 531 7 7
Genomic Location (Zv9):
Chromosome 15 (position 17133771)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18254144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GRAAACAAGTGACAAATGGYGACATCAAGCTTGAACTCCCAGACAACCCA[G/T]AGCGGTTTAGCACTTGTTGCTGTGTCCTGGCCAAAGAGGGATTCAACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144029 Nonsense 398 532 6 6
ENSDART00000147632 Nonsense 398 531 7 7
Genomic Location (Zv9):
Chromosome 15 (position 17133738)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18254111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCCCAGACAACCCAGAGCGGTTTAGCACTTGTTGCTGTGTCCTGGCC[A/T]AAGAGGGATTCAACTCGGGGAGATTTTATTTTGAAGTGCAGGTAAAACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link