fxyd6

Ensembl ID:
ENSDARG00000095094
ZFIN ID:
ZDB-GENE-030131-5919
Description:
FXYD domain-containing ion transport regulator 6 [Source:RefSeq peptide;Acc:NP_956141]
Human Orthologues:
FXYD1, FXYD6
Human Descriptions:
FXYD domain containing ion transport regulator 1 [Source:HGNC Symbol;Acc:4025]
FXYD domain containing ion transport regulator 6 [Source:HGNC Symbol;Acc:4030]
Mouse Orthologues:
Fxyd1, Fxyd6
Mouse Descriptions:
FXYD domain-containing ion transport regulator 1 Gene [Source:MGI Symbol;Acc:MGI:1889273]
FXYD domain-containing ion transport regulator 6 Gene [Source:MGI Symbol;Acc:MGI:1890226]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19104 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4594 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132461 Essential Splice Site None 99 1 8
ENSDART00000140850 Essential Splice Site None 99 1 9
ENSDART00000132461 Essential Splice Site None 99 1 8
ENSDART00000140850 Essential Splice Site None 99 1 9

The following transcripts of ENSDARG00000095094 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 13143372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCCCACTGTTGCCCCCCTTACAAGTGCCCTCAAGGAGACGAGACAAG[G/A]TAGGCTATGAAGTGACTTTCTAACTAGGGCGTGTGCTGTTGTGTTATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132461 Essential Splice Site None 99 1 8
ENSDART00000140850 Essential Splice Site None 99 1 9
ENSDART00000132461 Essential Splice Site None 99 1 8
ENSDART00000140850 Essential Splice Site None 99 1 9

The following transcripts of ENSDARG00000095094 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 13143372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCCCACTGTTGCCCCCCTTACAAGTGCCCTCAAGGAGACGAGACAAG[G/A]TAGGCTATGAAGTGACTTTCTAACTAGGGCGTGTRCTGTTGTGTTATAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n1wwoyrp