GTF2H1 (2 of 2)

Ensembl ID:
ENSDARG00000095079
Description:
general transcription factor IIH, polypeptide 1, 62kDa [Source:HGNC Symbol;Acc:4655]
Human Orthologue:
GTF2H1
Human Description:
general transcription factor IIH, polypeptide 1, 62kDa [Source:HGNC Symbol;Acc:4655]
Mouse Orthologue:
Gtf2h1
Mouse Description:
general transcription factor II H, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1277216]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37983 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139884 Nonsense 416 453 10 11
Genomic Location (Zv9):
Chromosome 25 (position 3256898)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3076921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGACATCATCAACTCCATCAGCATTATCCAGCACGAGATGAGGAGCTA[C/A]AAACCCCGGCTCACGCAGGTAACTGTGGGTAAACCCTGGATTATAGTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Amyloid A Levels: Genome-wide association study identifies two novel regions at 11p15.5-p13 and 1p31 with major impact on acute-phase serum amyloid A. (View Study)
  • Pancreatic cancer: Genome-wide association study of survival in patients with pancreatic adenocarcinoma. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link