casp8ap2

Ensembl ID:
ENSDARG00000095052
ZFIN ID:
ZDB-GENE-030826-8
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RHP0]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23697 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037584 Nonsense 408 605 7 7
ENSDART00000128616 None None 273 8 8

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 20 (position 23932852)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGAAAGCAGCAGACACGGAGGTGCAGAGTCAAGGGCACATGCATAAA[C/T]AAAACGCAGAAAGAACAAGCAGAGAAACGAGACAATCTGGATTGAGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/znaa6oh4