casp8ap2

Ensembl ID:
ENSDARG00000095052
ZFIN ID:
ZDB-GENE-030826-8
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RHP0]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32289 Nonsense Available for shipment Available now
sa37022 Nonsense Mutation detected in F1 DNA During 2016
sa23697 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037584 Nonsense 59 605 4 7
ENSDART00000128616 Nonsense 59 273 4 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23931471)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24050272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTTAACACTATCCTTTCTCCACGGACCATGGAATCTATGGATATATA[T/A]GAGGAAATTATCAGAGAAGAACAAGAAGAAAAGGAAGCAACTTACAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037584 Nonsense 204 605 7 7
ENSDART00000128616 Nonsense 204 273 7 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23932240)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24051041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTAAATCAGCAAACGGACAGGATCACTTCAACATCAATTTCAGCATCA[C/T]AGCCATTTGAGGTGCTCCAGAGATGTCCAAGAACTGAAAGTGAAAATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037584 Nonsense 408 605 7 7
ENSDART00000128616   None 273 8 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23932852)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24051653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGAAAGCAGCAGACACGGAGGTGCAGAGTCAAGGGCACATGCATAAA[C/T]AAAACGCAGAAAGAACAAGCAGAGAAACGAGACAATCTGGATTGAGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link