si:ch211-196n4.2

Ensembl ID:
ENSDARG00000095044
ZFIN ID:
ZDB-GENE-060503-582
Description:
Novel protein similar to vertebrate pim oncogene family [Source:UniProtKB/TrEMBL;Acc:A3KQP1]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23523 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133378 Essential Splice Site 72 303 3 6
ENSDART00000147081 Essential Splice Site 49 186 2 5
Genomic Location (Zv9):
Chromosome 19 (position 24254897)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24184312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCAGTAAAAATTGCCAGAAAGCCATCGAACATGAAATACATCCACATC[G/A]TAAGTAGACTTAAACATGTAAAGGCACTGACAACAGTATATTTGGGGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link