A3QK27_DANRE

Ensembl ID:
ENSDARG00000095039
Description:
Transporter [Source:UniProtKB/TrEMBL;Acc:A3QK27]
Mouse Orthologue:
1700039E15Rik
Mouse Description:
RIKEN cDNA 1700039E15 gene Gene [Source:MGI Symbol;Acc:MGI:1923963]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18748 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134683 Nonsense 115 175 2 3

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 3 (position 16208562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGCTGCCACTGATCATTGTTGTCATTTTTGAGACCGTCAGCGTGGCGT[G/A]GATTTACGGTGCAGATCGGTGAGGAATCTTTGTTTTATATGCTGATTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xqo7aa1i