trpm2

Ensembl ID:
ENSDARG00000095029
ZFIN ID:
ZDB-GENE-061214-4
Human Orthologue:
NUDT9
Human Description:
nudix (nucleoside diphosphate linked moiety X)-type motif 9 [Source:HGNC Symbol;Acc:8056]
Mouse Orthologue:
Nudt9
Mouse Description:
nudix (nucleoside diphosphate linked moiety X)-type motif 9 Gene [Source:MGI Symbol;Acc:MGI:1921417]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14804 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134331 Nonsense 109 197 5 7

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 54460882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGCGCAGGTGCTGGAGAGGATTCTGGGTAAAAAGTTAAATGAAAAGACC[A/T]AGACTCTTCTAAAAGCTGGAGAAGAGGTGAGCATGGYAAACGCAAAASAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xbk8zaab