thsd7ba

Ensembl ID:
ENSDARG00000095022
ZFIN ID:
ZDB-GENE-070621-2
Description:
Novel protein similar to human and mouse thrombospondin, type I, domain containing 7B (THSD7B) [Sour
Human Orthologue:
THSD7B
Human Description:
thrombospondin, type I, domain containing 7B [Source:HGNC Symbol;Acc:29348]
Mouse Orthologue:
Thsd7b
Mouse Description:
thrombospondin, type I, domain containing 7B Gene [Source:MGI Symbol;Acc:MGI:2443925]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8510 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9262 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132123 Essential Splice Site 367 1574 2 26
Genomic Location:
Chromosome 9 (position 10575934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GWAAAGGAGGCCTGCAACATCATTGGAGATCTGCTTCCAAACTGCCCAAG[G/A]TTTCTCTTTCATCCTCCCAATAATAAACTCCTAATGTACATGAATGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132123 Essential Splice Site 1154 1574 16 26
Genomic Location:
Chromosome 9 (position 10424608)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTGCATCCTCAACAGCACCTGCTTCAATTACCACTACAATGTYTCCAG[T/C]GGGTCTTACTCATTTTGCTACAACACAACACTGAATGTAACATGAGCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/huty25pp