otx1b

Ensembl ID:
ENSDARG00000094992
ZFIN ID:
ZDB-GENE-980526-400
Description:
Homeobox protein OTX1 B [Source:UniProtKB/Swiss-Prot;Acc:Q91994]
Human Orthologue:
OTX2
Human Description:
orthodenticle homeobox 2 [Source:HGNC Symbol;Acc:8522]
Mouse Orthologue:
Otx2
Mouse Description:
orthodenticle homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97451]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa96 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa96
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064083 Nonsense 209 323 4 4
Genomic Location (Zv9):
Chromosome 17 (position 24151124)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24304566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGTTCCGTCTCAGGCACAGCCAGCTCCACCTACCCCATGCCCTACAAC[C/T]AGACCACCGGCTACAGCCAGGGCTACCCGACTCCGTCCGGTTCTTACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link