ENSDARG00000094987

Ensembl ID:
ENSDARG00000094987
Human Orthologue:
RBBP6
Human Description:
retinoblastoma binding protein 6 [Source:HGNC Symbol;Acc:9889]
Mouse Orthologues:
AC099701.1, AC158570.1, Gm9343, Rbbp6
Mouse Descriptions:
predicted gene 9343 Pseudogene [Source:MGI Symbol;Acc:MGI:3645198]
retinoblastoma binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:894835]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27742 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134836 Nonsense 83 174 2 5
Genomic Location (Zv9):
Chromosome 11 (position 12570812)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 12440828
KASP Assay ID:
2260-4028.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGGTCATCATCAGACGGGTCCCTGCGGCTGGACTGAAGTCCTCCAAC[A/T]GAAGATTTGTTGGGTAAGTTATGTGAAATGAGCGCAATCTTCCTCTGATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link