NR2C2 (2 of 2)

Ensembl ID:
ENSDARG00000094967
Description:
nuclear receptor subfamily 2, group C, member 2 [Source:HGNC Symbol;Acc:7972]
Human Orthologue:
NR2C2
Human Description:
nuclear receptor subfamily 2, group C, member 2 [Source:HGNC Symbol;Acc:7972]
Mouse Orthologue:
Nr2c2
Mouse Description:
nuclear receptor subfamily 2, group C, member 2 Gene [Source:MGI Symbol;Acc:MGI:1352466]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34524 Nonsense Mutation detected in F1 DNA During 2017
sa12029 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34524
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135801 Nonsense 105 338 4 9

The following transcripts of ENSDARG00000094967 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55380201)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53247602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAGCGGGTAAAGTCCTGCTGGCGTCCCCAGAGAGCTCCAGCGCCAAA[C/T]AGCTCATCTTCGCCACTGCCGACAGCCTGGTACCCGGCAGAATACAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12029
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135801 Essential Splice Site 215 338 6 9

The following transcripts of ENSDARG00000094967 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 55378459)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53249344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGTTCTGCCGGCTCCGCAAGTGCCTGGAGATGGGCATGAAGATGGAGT[G/A]TGAGTGACGCAGAAACAGCAGGGCTGGGGGGCGATGAATSCAATCGAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link