ccdc132

Ensembl ID:
ENSDARG00000094936
ZFIN ID:
ZDB-GENE-060503-325
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LYA7]
Human Orthologue:
CCDC132
Human Description:
coiled-coil domain containing 132 [Source:HGNC Symbol;Acc:25956]
Mouse Orthologue:
Ccdc132
Mouse Description:
coiled-coil domain containing 132 Gene [Source:MGI Symbol;Acc:MGI:1920538]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3030 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa3030
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000146468 Nonsense 263 278 6 6
ENSDART00000146468 Nonsense 263 278 6 6

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 19 (position 41645988)
KASP Assay ID:
554-3435.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTAACCTGGTCAACGTCTGCCTCGGGTCCCACATCAACAAGAAAGCA[C/T]GACAGAAACTCCTCGCAGCCATTGATGACATTGACCGGCCCAAAAGATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qf2huq9i