B8JIF7_DANRE

Ensembl ID:
ENSDARG00000094906
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JIF7]
Human Orthologue:
EFCAB6
Human Description:
EF-hand calcium binding domain 6 [Source:HGNC Symbol;Acc:24204]
Mouse Orthologue:
Efcab6
Mouse Description:
EF-hand calcium binding domain 6 Gene [Source:MGI Symbol;Acc:MGI:1924877]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13689 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131559 Nonsense 65 152 2 3

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 1 (position 16401389)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCAGGTGAGAGGTGCGGACTTTCTGCAGGTGTTGGGAAAGTTTGAWT[T/A]GCAWCTGAAAAGAGAGCAGCTGGGTCTGTTTCTGTCTCGCTGTGGTCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mhocvsl0