B8JIF7_DANRE

Ensembl ID:
ENSDARG00000094906
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JIF7]
Human Orthologue:
EFCAB6
Human Description:
EF-hand calcium binding domain 6 [Source:HGNC Symbol;Acc:24204]
Mouse Orthologue:
Efcab6
Mouse Description:
EF-hand calcium binding domain 6 Gene [Source:MGI Symbol;Acc:MGI:1924877]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32638 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13689 Nonsense Available for shipment Available now
sa39582 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131559 Essential Splice Site 50 152 1 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16404855)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16970023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGATGAAGGCAGAGTTTGATAAACTGGATCCTGAAAGCACCGGAAAG[G/A]TAGCAAACAGTGTCACACCTCTCAAACAAACAGGTAGAAAAATGGTAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13689
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131559 Nonsense 65 152 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16401389)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16966557
KASP Assay ID:
2259-0387.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCAGGTGAGAGGTGCGGACTTTCTGCAGGTGTTGGGAAAGTTTGAWT[T/A]GCAWCTGAAAAGAGAGCAGCTGGGTCTGTTTCTGTCTCGCTGTGGTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131559 Nonsense 70 152 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 16401375)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 16966543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGGACTTTCTGCAGGTGTTGGGAAAGTTTGATTTGCATCTGAAAAGA[G/T]AGCAGCTGGGTCTGTTTCTGTCTCGCTGTGGTCTGAAGATTAAAAAGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link