ABCC6 (3 of 3)

Ensembl ID:
ENSDARG00000094901
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Source:HGNC Symbol;Acc:57]
Human Orthologue:
ABCC6
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Source:HGNC Symbol;Acc:57]
Mouse Orthologue:
Abcc6
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 Gene [Source:MGI Symbol;Acc:MGI:1351634]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20081 Nonsense Available for shipment Available now
sa40117 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33249 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131340 Nonsense 2 1462 1 30
Genomic Location (Zv9):
Chromosome 3 (position 36817924)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36681682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACAAAGTGCTTCCAGCACACGATACTGGTGTGGTTCCCTTGTTTCTA[T/A]CTCTGGATCTGTGCCCCTTTCTACTGCTTGTATCTCAAATTCTATTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131340 Essential Splice Site 713 1462 17 30
Genomic Location (Zv9):
Chromosome 3 (position 36807656)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36671414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCATCGTATCACAAGAGACAATGCTAACTACATTTTTACAATGTTCAC[A/T]GGGGTTAAATCTGTCAGGAGGTCAAAAACAGAGAGTAAGTCTGGCACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131340 Nonsense 1263 1462 27 30
Genomic Location (Zv9):
Chromosome 3 (position 36803143)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36666901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCATTCATCAAATCCAATCAGGTTGGAATTGTGGGAAGAACAGGAGCT[G/T]GAAAATCATCTCTGGCTCTTGGAATCTTTCGTATCCTTGAGGCAGCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link