ABCC6 (3 of 3)

Ensembl ID:
ENSDARG00000094901
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Source:HGNC Symbol;Acc:57]
Human Orthologue:
ABCC6
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Source:HGNC Symbol;Acc:57]
Mouse Orthologue:
Abcc6
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 6 Gene [Source:MGI Symbol;Acc:MGI:1351634]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20081 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131340 Nonsense 2 1462 1 30
Genomic Location:
Chromosome 3 (position 36817924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACAAAGTGCTTCCAGCACACGATACTGGTGTGGTTCCCTTGTTTCTA[T/A]CTCTGGATCTGTGCCCCTTTCTACTGCTTGTATCTCAAATTCTATTACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v9amq1i2