si:ch211-237h13.5

Ensembl ID:
ENSDARG00000094891
ZFIN ID:
ZDB-GENE-081104-190
Description:
Novel protein with a Pentaxin family domain [Source:UniProtKB/TrEMBL;Acc:B0V212]
Human Orthologue:
GPR144
Human Description:
G protein-coupled receptor 144 [Source:HGNC Symbol;Acc:18651]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34518 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139233 Essential Splice Site 201 294 5 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 54876303)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52829041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCAGTGTCATTTGGGCTTTTGCAGGGCCGGTGCTCTTTGTTTTGGCT[G/A]TAAGTATGTCTTTTATCTTATTTCAGCTAATAGGATTGTAGAATACTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link