B8JLN9_DANRE

Ensembl ID:
ENSDARG00000094873
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JLN9]
Human Orthologue:
KIAA0664
Human Description:
KIAA0664 [Source:HGNC Symbol;Acc:29094]
Mouse Orthologue:
1300001I01Rik
Mouse Description:
RIKEN cDNA 1300001I01 gene Gene [Source:MGI Symbol;Acc:MGI:1921398]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38662 Nonsense Mutation detected in F1 DNA During 2017
sa21182 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133518 Nonsense 142 641 3 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 4693325)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4436356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTCTTGACCCCATGATGGAGCTCCAGGACATCAAAGGCTTCAAAGCT[G/T]GAGTTACTCTTCGTCTAGTGGAAGGTAAACTGGAGGAGCTCTACTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133518 Essential Splice Site 296 641 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 4683315)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4426346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGCAGTGTGACATCACTTCCTGCCCACGTGGATTTTACCTGAACAGG[T/C]ACGAGAGTTTCATTTCAGAACTGCATTCTGCTCTATTTCTGCATTACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link