si:ch73-313l22.2

Ensembl ID:
ENSDARG00000094868
ZFIN ID:
ZDB-GENE-091204-459
Human Orthologue:
CABIN1
Human Description:
calcineurin binding protein 1 [Source:HGNC Symbol;Acc:24187]
Mouse Orthologue:
Cabin1
Mouse Description:
calcineurin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1298375]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41305 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000146976 Nonsense 293 317 6 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 54057923)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51793282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGTCGGCAGCTAATGTGAAGAAGGACACCCTGGCTCAGCCTGCGCTA[G/T]AAGTGCAGGAGACGTCCAGTCAGGAGTCGTCCCTGGAGAGTGAATCAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link