ddx46

Ensembl ID:
ENSDARG00000094863
ZFIN ID:
ZDB-GENE-030131-667
Description:
Probable ATP-dependent RNA helicase DDX46 [Source:UniProtKB/Swiss-Prot;Acc:Q4TVV3]
Human Orthologue:
DDX46
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 [Source:HGNC Symbol;Acc:18681]
Mouse Orthologue:
Ddx46
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 Gene [Source:MGI Symbol;Acc:MGI:1920895]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15606 Nonsense Available for shipment Available now
sa37388 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37389 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099265 Nonsense 274 1035 7 23
Genomic Location (Zv9):
Chromosome 21 (position 44362571)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45585869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGATGCCGCACGCCACCAAGAARAAGGGGGAGCTGATGGAGAACGAC[C/T]AGGAYGCCATGGAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACACACACANNNNNNNNNNNNNNNNNNNNNNNNNNNNCACACTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099265 Essential Splice Site 582 1035 None 23

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 44367502)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45580938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGTGGGCGGACGGAGCGTGGTGTGTTCAGATGTGGAGCAGCATGTGG[T/G]GAGGGAGCACACACACACACACACACACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099265 Essential Splice Site 797 1035 None 23

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 44370243)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45578197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGGCGCTCGGCCTGCACGACTCTGATGATGAGGACACCGCGCTCGACG[T/C]GAGTCTCCGTGTGTGTGTGTGTGTGTGTGTGTGGCACTGTCTGTATAACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link