LOC566119

Ensembl ID:
ENSDARG00000094845
Human Orthologues:
ANGPTL1, ANGPTL2, ANGPTL6, FGA
Human Descriptions:
angiopoietin-like 1 [Source:HGNC Symbol;Acc:489]
angiopoietin-like 2 [Source:HGNC Symbol;Acc:490]
angiopoietin-like 6 [Source:HGNC Symbol;Acc:23140]
fibrinogen alpha chain [Source:HGNC Symbol;Acc:3661]
Mouse Orthologues:
Angptl1, Angptl2, Angptl6, Fga
Mouse Descriptions:
angiopoietin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1919963]
angiopoietin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1347002]
angiopoietin-like 6 Gene [Source:MGI Symbol;Acc:MGI:1917976]
fibrinogen alpha chain Gene [Source:MGI Symbol;Acc:MGI:1316726]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14390 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131567 Essential Splice Site 81 222 2 4
Genomic Location:
Chromosome 1 (position 59729238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGAGTACAARAGAGGATTCGGGTCTATGGAGGGCGAACACTGGATGG[G/A]TGAGATCTGACATCCGTCTGWGNNNNNNNNTAARTGTTCATGTCYAGYGATTGGTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wo2jd1wy