si:dkey-21e2.13

Ensembl ID:
ENSDARG00000094840
ZFIN ID:
ZDB-GENE-050208-379
Description:
Novel protein containing trypsin domains [Source:UniProtKB/TrEMBL;Acc:Q1LUR8]
Human Orthologue:
GZMM
Human Description:
granzyme M (lymphocyte met-ase 1) [Source:HGNC Symbol;Acc:4712]
Mouse Orthologue:
Gzmm
Mouse Description:
granzyme M (lymphocyte met-ase 1) Gene [Source:MGI Symbol;Acc:MGI:99549]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24150 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136943 Essential Splice Site 207 258 4 5
ENSDART00000141097 Essential Splice Site 202 239 4 5
Genomic Location (Zv9):
Chromosome 22 (position 19596734)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 19253427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGCTTCAGAGATGATCTGTGTTTATGGTCCTGGTGGAACCTGCAAAG[T/C]ATGTATTACAATTAATTCAGACTTAATTTTAATGTTTGAACTAATTTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link