LOC558353

Ensembl ID:
ENSDARG00000094832
Human Orthologue:
F13A1
Human Description:
coagulation factor XIII, A1 polypeptide [Source:HGNC Symbol;Acc:3531]
Mouse Orthologue:
F13a1
Mouse Description:
coagulation factor XIII, A1 subunit Gene [Source:MGI Symbol;Acc:MGI:1921395]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3286 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140383 Nonsense 342 711 7 14
Genomic Location:
Chromosome 24 (position 2514074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTGCTCATGACAACACAGGCAACCTGAAGWCAGACATTGTGCTTGAT[G/T]AGGAYGGGAGAATGGACAAAAGCCGAACAAGAGATTCRGTCTGGTAAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pbf6eqe5