si:dkey-183c2.5

Ensembl ID:
ENSDARG00000094799
ZFIN ID:
ZDB-GENE-081103-53
Description:
Novel protein similar to vertebrate plexin family [Source:UniProtKB/TrEMBL;Acc:B0S6W7]
Human Orthologue:
PLXNB2
Human Description:
plexin B2 [Source:HGNC Symbol;Acc:9104]
Mouse Orthologue:
Plxnb2
Mouse Description:
plexin B2 Gene [Source:MGI Symbol;Acc:MGI:2154239]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6934 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137847 Essential Splice Site 481 544 4 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 13550424)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14486277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGTTTGATTCAACTTTGAATCACCTGTACATCACCACTGGCAAAAAG[G/A]TTTGCTTATGAACACATTMAYAATGTATAGRTAACGTTWKGTCAACAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link