twf1l

Ensembl ID:
ENSDARG00000094792
ZFIN ID:
ZDB-GENE-030131-7638
Description:
Twinfilin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q6GMH3]
Human Orthologue:
TWF2
Human Description:
twinfilin, actin-binding protein, homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:9621]
Mouse Orthologue:
Twf2
Mouse Description:
twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1346078]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16143 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065006 Nonsense 181 347 5 8

The following transcripts of ENSDARG00000094792 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 6 (position 41424272)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTGTGGACCCCAAACATCAGACTCTACAGGGTCTTGCTTTTCCMTTA[C/T]AGGCTGAAGCCAAACGTGCTTTAAAGCASCTCGCAGAGAGACGCATCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u5b3cyhu