si:dkey-14p11.4

Ensembl ID:
ENSDARG00000094787
ZFIN ID:
ZDB-GENE-090313-187

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11769 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133930 Nonsense 137 181 3 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 9522633)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9480774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCTCTCCAGCTGACAGAGCAGGTTCATGAGCTGCACGCTCTGCTGT[C/A]GGAGGYGAGAGAGAAGGCTCATGGAGCACAAGAAGCTCTGTCACAGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link