si:dkey-125i10.3

Ensembl ID:
ENSDARG00000094760
ZFIN ID:
ZDB-GENE-060526-198
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BHL5]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6973 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142915 Nonsense 198 406 6 6

The following transcripts of ENSDARG00000094760 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 24927886)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22755151
KASP Assay ID:
554-5309.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGAAGACATCTACAGACACTCCTAAAAAGGATGTAGTGGAAAAACCAT[T/A]AGTCAAAACTACAGAAGAACCATCGAAGACACTTRCAGATGCTCCCGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link