rpe65b

Ensembl ID:
ENSDARG00000094752
ZFIN ID:
ZDB-GENE-050410-16
Description:
retinal pigment epithelium-specific protein b [Source:RefSeq peptide;Acc:NP_001082902]
Human Orthologue:
RPE65
Human Description:
retinal pigment epithelium-specific protein 65kDa [Source:HGNC Symbol;Acc:10294]
Mouse Orthologue:
Rpe65
Mouse Description:
retinal pigment epithelium 65 Gene [Source:MGI Symbol;Acc:MGI:98001]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21240 Nonsense Available for shipment Available now
sa21239 Nonsense Mutation detected in F1 DNA During 2014
sa25390 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21240
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076542 Nonsense 79 532 3 14
Genomic Location:
Chromosome 8 (position 17214293)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCAGGCTCTCATTCACAAGTTTGACCTGAAGGACGGACGTGTAACCTA[T/A]CATCGCAAGTAAAAATCTAGACCTTCTCACATTTTAAAAAGTTAATCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076542 Nonsense 144 532 5 14
Genomic Location:
Chromosome 8 (position 17213302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACAGACAACTGTTCTGTAAACATTTACCCCATCGGTGAAGACTTCTA[T/A]GCCTGCACTGAAACCAACTTCATTACCAAAGTCAATCCTGATACCCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076542 Nonsense 342 532 10 14
Genomic Location:
Chromosome 8 (position 17211069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTTTCTCCTTTTACTGACAGCCATGAATTTGTGTACAATTATCTATA[T/A]TTGGCAAATCTGAGGCAAAACTGGGAGGAAGTCAAAAAAGCAGCCCTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jrrubrbl