si:ch211-242m24.6

Ensembl ID:
ENSDARG00000094722
ZFIN ID:
ZDB-GENE-030616-155
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R0U7]
Human Orthologue:
CCDC157
Human Description:
coiled-coil domain containing 157 [Source:HGNC Symbol;Acc:33854]
Mouse Orthologue:
Ccdc157
Mouse Description:
coiled-coil domain containing 157 Gene [Source:MGI Symbol;Acc:MGI:3041210]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41260 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137397   None 222 None 3
ENSDART00000141435 Nonsense 134 319 2 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 37664968)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36520391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCTGTGGTCAAACGCTACTGGAAAAACCTGCTTCAGCTAAACAGTCAA[C/T]AAAAACAAGAGGTGAGAAGTACAATAATGACAAAACAGACTAGGTTAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link