hbl2

Ensembl ID:
ENSDARG00000094681
ZFIN ID:
ZDB-GENE-070912-286
Human Orthologues:
AL512662.2, MBL2, SFTPA1, SFTPA2, SFTPD
Human Descriptions:
mannose-binding lectin (protein C) 2, soluble (opsonic defect) [Source:HGNC Symbol;Acc:6922]
surfactant protein A1 [Source:HGNC Symbol;Acc:10798]
surfactant protein A2 [Source:HGNC Symbol;Acc:10799]
surfactant protein D [Source:HGNC Symbol;Acc:10803]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B5MCL0]
Mouse Orthologues:
Mbl1, Mbl2, Sftpa1, Sftpd
Mouse Descriptions:
mannose-binding lectin (protein A) 1 Gene [Source:MGI Symbol;Acc:MGI:96923]
mannose-binding lectin (protein C) 2 Gene [Source:MGI Symbol;Acc:MGI:96924]
surfactant associated protein A1 Gene [Source:MGI Symbol;Acc:MGI:109518]
surfactant associated protein D Gene [Source:MGI Symbol;Acc:MGI:109515]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9228 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143027 Nonsense 58 253 1 3
Genomic Location (Zv9):
Chromosome 2 (position 37632147)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37911279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCGGGACACAATGGTCTGCCTGGCAGAGAYGGGAAAGACGGAAGAGAT[G/T]GAGCCACTGGACCCAAAGGAGAGAAGGGAGAGCCAGGTTTGTGTCTGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link