B8A4R7_DANRE

Ensembl ID:
ENSDARG00000094624
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A4R7]
Human Orthologue:
C6orf27
Human Description:
chromosome 6 open reading frame 27 [Source:HGNC Symbol;Acc:13939]
Mouse Orthologue:
D17H6S56E-3
Mouse Description:
DNA segment, Chr 17, human D6S56E 3 Gene [Source:MGI Symbol;Acc:MGI:1306798]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18346 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138256 Essential Splice Site 80 338 2 5

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 1 (position 40717704)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTCACAGAGTAGTGACTTTACACCAAAAGCCAATCGTCCTTTCATTG[G/A]TATGATATCGTCTTCAAATTGATATTTCTTGATTATTAATAKACATTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yk5u7o0k