opn1mw2

Ensembl ID:
ENSDARG00000094617
ZFIN ID:
ZDB-GENE-030728-5
Description:
Green-sensitive opsin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q8AYM8]
Human Orthologue:
RHO
Human Description:
rhodopsin [Source:HGNC Symbol;Acc:10012]
Mouse Orthologue:
Rho
Mouse Description:
rhodopsin Gene [Source:MGI Symbol;Acc:MGI:97914]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33930 Nonsense Available for shipment Available now
sa40768 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025241 Nonsense 66 349 1 5
Genomic Location (Zv9):
Chromosome 6 (position 41117445)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41189045
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCGGGCTGCCGATCAACGTGCTCACGCTGTTGGTCACAGCTCAGCAC[A/T]AAAAGCTGAGACAGCCTTTAAATTATATTTTGGTGAACTTGGCTTTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025241 Essential Splice Site 177 349 3 5
Genomic Location (Zv9):
Chromosome 6 (position 41118531)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41190131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATAGGGTCTGAAAAGATGTGTGACAATCTTATTTTATTGTTTTGACACA[G/A]ATACATCCCAGAGGGAATGCAGACATCCTGCGGACCAGATTATTACACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link