si:ch73-256j6.3

Ensembl ID:
ENSDARG00000094604
ZFIN ID:
ZDB-GENE-070705-224
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WWL7]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3159 Nonsense F2 line generated During 2017
sa43760 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa3159
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132062 Nonsense 52 392 1 4
Genomic Location (Zv9):
Chromosome 22 (position 4554091)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4528505
KASP Assay ID:
554-2587.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGACCAACAGATTCTCTGTATTTGATGATGTTCTTGATGGGAGATTC[A/T]GAGACAGACTGAAACTGGACAAKAAAACTGGATCTCTGACCATCAYAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43760
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132062 Essential Splice Site 94 392 1 4
Genomic Location (Zv9):
Chromosome 22 (position 4553961)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4528375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTACAGAACAAAGAGATTATCCTCAGGGCAGTCTATCTTATTGTCTATG[G/A]TGAGTTAAATGGTAGTTTCACCTATTTATTTTCTTTTGTTTTTGCGCGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link