si:dkey-21h14.3

Ensembl ID:
ENSDARG00000094603
ZFIN ID:
ZDB-GENE-041210-92
Description:
Novel protein containing multiple scavenger receptor cysteine-rich (SRCR) domains similar to vertebr
Human Orthologues:
AC008735.1, CD5L
Human Descriptions:
CD5 molecule-like [Source:HGNC Symbol;Acc:1690]
Scavenger receptor cysteine-rich domain-containing protein LOC284297 [Source:UniProtKB/Swiss-Prot;Ac
Mouse Orthologues:
A430110N23Rik, Cd5l
Mouse Descriptions:
CD5 antigen-like Gene [Source:MGI Symbol;Acc:MGI:1334419]
RIKEN cDNA A430110N23 gene Gene [Source:MGI Symbol;Acc:MGI:3606211]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2159 Nonsense F2 line generated During 2017
sa40238 Nonsense Mutation detected in F1 DNA During 2017
sa40237 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20224 Nonsense Available for shipment Available now
sa40236 Nonsense Mutation detected in F1 DNA During 2017
sa26244 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2159
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135511 Nonsense 907 5840 10 57
Genomic Location (Zv9):
Chromosome 4 (position 10182085)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11118712
KASP Assay ID:
554-2837.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTYATAATCAGACGTGGATGTCAGTGTGTGAYGCTGCCTTTGACCAG[C/T]AGGATGCAGAGGTTGTGTGTAGAGAGCTGGACTGTGGGGCTCCTGTRCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135511 Nonsense 1147 5840 12 57
Genomic Location (Zv9):
Chromosome 4 (position 10181019)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11117646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACTCAGATGTGGACACAAGAGATTCACTGCAGAGGAGAGGAGTCTTA[T/A]ATATCTTTCTGTCCAACATCTTCTCTCAAACACATTTGTACTCATGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135511 Essential Splice Site 1489 5840 15 57
Genomic Location (Zv9):
Chromosome 4 (position 10179740)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11116367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAACATGACTGTCGACACAAGGAGGATGTAGGAGTCGTCTGCTCTGG[T/C]GAACAGTTAATATCATTTTTGATAATAATATACAGAATACATTTAATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135511 Nonsense 1508 5840 16 57
Genomic Location (Zv9):
Chromosome 4 (position 10179254)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11115881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAACTGAGGGCTGTAAAGGGACTCTGGAGGTTTTCTACAATGGATCCTG[G/A]GGAAATGTGTGCTGGAATCAGATGGACAGAGACACAGCGAGTCTGATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135511 Nonsense 2913 5840 29 57
Genomic Location (Zv9):
Chromosome 4 (position 10157567)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11094194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGGAAATGAGTCTCAGATTCGATTGTGTTCAACCGTGAATGACACA[C/T]AGTGCTCTCAGGAAAACAACGTAGCGCTGAAATGTGCAGGTAAAAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135511 Nonsense 4797 5840 47 57
Genomic Location (Zv9):
Chromosome 4 (position 10137375)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11074002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACGTCCCTGTGGAGCTGCTCTTCTCCAGGCTGGGGAAAACATGACTG[T/A]CAACACAAGGAGGATGTAGGAGTCGTCTGCTCTGGTAAGGAAAGAAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link