si:dkey-15h8.16

Ensembl ID:
ENSDARG00000094598
ZFIN ID:
ZDB-GENE-050208-707
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LW42]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37415 Nonsense Mutation detected in F1 DNA During 2017
sa24060 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa37415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133211 Nonsense 41 346 2 3

The following transcripts of ENSDARG00000094598 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 3126850)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1939698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGAAGGACAGTGAGAAGATGAGTGATCCAGAACCCTGCAGAATTAAA[C/T]AGGAAGAGACTGAAGAACTAATAGGTTTGTGTTTATTCATTACTCACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133211 Missense 129 346 3 3

The following transcripts of ENSDARG00000094598 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 3130326)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1943174
KASP Assay ID:
2261-6291.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCCACAGTGGAGAGAAACCCTTCAAGTGTTCACACTGCGACATGAGG[T/G]TCAATCGTTTAGCAATCCTGAAATCCCACGAGAGAACTCACACTGGAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link