si:ch211-167h3.2

Ensembl ID:
ENSDARG00000094582
ZFIN ID:
ZDB-GENE-091204-103
Human Orthologue:
ATP8B1
Human Description:
ATPase, aminophospholipid transporter, class I, type 8B, member 1 [Source:HGNC Symbol;Acc:3706]
Mouse Orthologue:
Atp8b1
Mouse Description:
ATPase, class I, type 8B, member 1 Gene [Source:MGI Symbol;Acc:MGI:1859665]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6661 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000146950 Nonsense 187 255 5 5
Genomic Location (Zv9):
Chromosome 21 (position 3870613)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3467869
KASP Assay ID:
554-5253.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCACAGTGGGTTGTTTTCCTGCAGGTCCAGAGGAACAGGAAGAAATA[C/A]GAGCTTGAGGATGAAGAAGACGAGAGGAAGAAGAGGAAGCCCACWTTCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link