si:ch73-194h10.3

Ensembl ID:
ENSDARG00000094521
ZFIN ID:
ZDB-GENE-100922-173

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9098 Nonsense Mutation detected in F1 DNA During 2017
sa8526 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147253 Nonsense 59 122 2 2
ENSDART00000147253 Nonsense 59 122 2 2
Genomic Location (Zv9):
Chromosome 6 (position 27824067)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28125278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAARTATCCAAAGACCTGGAGCGTGCAGTTTCCTGCGCARAAGCTGTGGY[G/A]GTCATGGAGGAGCAAAGAGCATGAGACACCCACAGGTGACCTACTCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8526
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147253 Nonsense 59 122 2 2
ENSDART00000147253 Nonsense 59 122 2 2
Genomic Location (Zv9):
Chromosome 6 (position 27824067)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28125278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAARTATCCAAAGACCTGGAGCGTGCAGTTTCCTGCGCARAAGCTGTGGY[G/A]GTCATGGAGGAGCAAAGAGCATGAGACACCCACAGGTGACCTACTCACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link